If you have been reading about lactam bridge and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2025-09-13. Numbers and descriptions here follow the published literature rather than marketing material.
Identity and purity are usually established with reversed-phase high-performance liquid chromatography combined with mass spectrometry. A gradient of water and acetonitrile containing trifluoroacetic acid is a common mobile phase, and ultraviolet detection near 214 nanometres responds to the peptide backbone. Mass spectrometry confirms the expected molecular mass and helps reveal truncation or oxidation products. Purity is reported as a peak-area percentage, a figure that depends on the wavelength and gradient used, so values from different laboratories are not always directly comparable. Peptide mapping and amino acid analysis provide additional confirmation when required.
Regulatory status varies by jurisdiction, where approved prescription products, compounded preparations and research-grade material are treated as distinct categories with different documentation requirements. Suppliers of research material commonly issue a certificate of analysis listing purity, identity and sometimes endotoxin content. Independent verification by a third-party laboratory is often recommended because self-reported figures are difficult to check. Literature discussions usually state the source, purity and storage conditions of the material used, since these details affect reproducibility. Analysts note that a reported purity figure does not by itself describe biological activity.
Lyophilised peptide is generally held below minus twenty degrees Celsius, protected from light and moisture, because hydrolysis and oxidation accumulate faster at ambient temperature. Once reconstituted, solutions are typically kept between two and eight degrees Celsius and used within a short window defined by the supplier. Repeated freeze-thaw cycles are avoided since they promote aggregation and loss of soluble material. Container material matters as well, because peptides adsorb to certain plastics and glass surfaces at low concentration. Stability figures supplied by a vendor apply only to the specific lot and buffer that were tested.
Bremelanotide, developed under the code PT-141, is a synthetic cyclic heptapeptide analogue of alpha-melanocyte-stimulating hormone. Its structure is Ac-Nle-cyclo[Asp-His-D-Phe-Arg-Trp-Lys]-OH, with a lactam bridge joining the aspartate and lysine side chains. The molecule has the formula C50H68N14O10 and a monoisotopic mass near 1025 daltons. It is commonly prepared as the acetate salt and appears as a white to off-white lyophilised powder in solid form. The free acid is the pharmacologically relevant species, while the counter-ion improves handling and dissolution.
Early research on PT-141 grew out of work on melanotan II, a related cyclic peptide studied for pigmentation. Investigators observed that centrally acting melanocortin agonists also influenced sexual behaviour in animal models, and the programme shifted toward that endpoint. A nasal formulation was evaluated in clinical trials but showed inconsistent absorption, and later studies used subcutaneous administration instead. Regulatory approval in the United States followed in 2019 for a defined population of premenopausal women with acquired, generalised hypoactive sexual desire disorder. That approval was specific to that group rather than a broad indication.
| Property | Value | Notes |
|---|---|---|
| Appearance | White to off-white powder | Lyophilised solid before reconstitution |
| Solubility class | Soluble in water and aqueous buffers | Stock solutions often prepared in sterile water |
| Typical storage temperature | Minus twenty degrees Celsius or below | Dry powder, protected from light |
| Typical analytical method | Reversed-phase HPLC with mass spectrometry | Ultraviolet detection near 214 nanometres |
| Common synonyms | PT-141 and bremelanotide | Code and generic name used interchangeably |
The compound emerged from a research programme examining melanocortin analogues for effects on skin pigmentation. During early human studies, participants reported spontaneous erections as an unexpected side effect, which redirected development toward sexual function rather than tanning. An intranasal formulation was investigated in clinical trials but did not reach market approval. A subcutaneous injectable version later completed the regulatory process, and the nasal route does not appear in approved labelling.
Approved use is narrow and jurisdiction-specific. In the United States, the injectable product is authorised for premenopausal women with acquired, generalised hypoactive sexual desire disorder, a diagnosis that requires documented distress. It is not approved for men, for postmenopausal women, or for use alongside hormonal contraceptives under the approved labelling. Outside regulated markets, the same peptide is frequently sold as a research chemical, where identity, purity, and sterility are not independently verified.
Bremelanotide is a synthetic cyclic heptapeptide developed as an analogue of alpha-melanocyte-stimulating hormone, a naturally occurring peptide involved in pigmentation and appetite signalling. Its structure contains seven amino acid residues joined by a lactam bridge that closes the ring between two side chains. The molecular formula is C50H68N14O10 and the nominal molecular mass is near 1025 daltons. Much of the early laboratory literature refers to the same molecule by the development code PT-141.
Routine characterisation of bremelanotide relies on reversed-phase high-performance liquid chromatography with ultraviolet detection near 214 nm, where the peptide backbone absorbs. Mass spectrometry, typically in tandem mode with electrospray ionisation, confirms identity and supports quantification in biological matrices. Additional checks include amino acid analysis, peptide mapping after enzymatic digestion, and confirmation of the lactam bridge, since incomplete cyclisation produces a mass-shifted by-product. Purity values above 95 percent are common in reference-grade material, though reports vary in how strictly related substances are resolved from the parent peak.
The lyophilised solid is relatively stable when kept dry, protected from light and held at reduced temperature, commonly minus 20 degrees Celsius or lower for long-term storage. In solution the peptide is more vulnerable: tryptophan oxidation, hydrolysis of the lactam bridge and aggregation all become relevant over time, and the rate depends on pH, buffer composition and concentration. Repeated freeze-thaw cycles are generally avoided because they promote aggregation. Aqueous working solutions are typically prepared fresh or split into single-use aliquots to limit degradation before analysis.
Published studies differ in design, population and endpoint definition, so results are not always directly comparable across reports. Some trials used patient-reported measures of desire and distress, while others tracked physiological or behavioural outcomes. Questions that remain open include the durability of effects beyond short follow-up periods, the frequency of transient blood pressure elevation observed after administration, and whether a subtype-selective analogue could separate central effects from pigmentation-related activity. These points are usually framed as unresolved rather than settled in review literature.
After subcutaneous administration, plasma concentrations rise within roughly thirty minutes and the elimination half-life is short, on the order of two to three hours. Reported physiological responses include transient increases in blood pressure and nausea, which tended to diminish with repeated dosing in trial settings. Because the peptide clears quickly, effects are not expected to persist long after a dose. Absorption from non-injected routes is poorly characterised, and nasal delivery produced variable plasma levels in older work.
Clinical research typically uses randomised, double-blind, placebo-controlled designs. The most common primary endpoint is the desire domain score of the Female Sexual Function Index, sometimes paired with a distress measure. Secondary outcomes include arousal, satisfaction, and event-based counts of satisfying sexual episodes. Across trials, average improvements are modest and individual responses vary widely. Whether benefits persist beyond a few months, and whether they depend on baseline hormone status, remain open questions rather than settled findings.
Melanocortin receptors form a family of five G-protein-coupled receptors designated MC1 through MC5. Bremelanotide binds most strongly at MC4R and MC1R, with weaker activity reported at MC3R and MC5R. MC4R is expressed in hypothalamic nuclei that coordinate energy balance and aspects of sexual behaviour. The prevailing interpretation is that central MC4R activation, rather than peripheral vascular effects alone, drives the reported changes in desire. This account remains partly inferential, since direct receptor-level measurement in living humans is not practical.
Bremelanotide acts as an agonist at melanocortin receptors, a family of five G-protein-coupled receptors labeled MC1 through MC5. Binding studies indicate activity at several of these subtypes rather than strict selectivity for one. Signalling proceeds mainly through Gs-mediated activation of adenylyl cyclase, raising intracellular cyclic AMP. The MC4 receptor, expressed in hypothalamic and limbic circuits, is widely regarded as the subtype most relevant to sexual response. Because the molecule is not subtype-selective, effects at other melanocortin receptors are expected and are used to explain some observed side effects.
The peptide contains seven amino acids arranged in a ring, closed by a lactam bridge between a side-chain acid and an amine. This cyclic constraint holds the backbone in a defined conformation and increases resistance to enzymatic breakdown relative to linear analogs. N-terminal acetylation and a C-terminal amide further protect the molecule from exopeptidases. The result is a compound with a comparatively long circulation time for a small peptide. Structural modification of the bridge alters receptor affinity, which is one reason analogs in this family differ in their subtype preferences.
Whether the behavioral effect originates centrally, peripherally, or through both remains an active question. Animal experiments using receptor antagonists and site-specific injections point toward hypothalamic melanocortin circuits as a key locus, but translating those findings to humans is not straightforward. Blood pressure changes observed in trials suggest a vascular component that may be peripherally mediated. The relationship between receptor occupancy and reported effect has not been mapped in humans, and no validated biomarker predicts response. This gap makes it difficult to explain individual variability on pharmacological grounds alone.
== Reactions == Metal carbonyls are important precursors for the synthesis of other organometallic complexes. Common reactions are the substitution of carbon monoxide by other ligands, the oxidation or reduction reactions of the metal center, and reactions at the carbon monoxide ligand.
== Side effects == The most common adverse effects of Lamividine/zidovudine are similar to other NRTI's and includes headache, neutropenia, anemia, nausea, vomiting, myopathy and nail pigmentation. More serious and potentially life-threatening adverse effects reported include lactic acidosis with hepatic steatosis, but this rare adverse event is mostly associated with Zidovudine. HIV-positive patients with chronic hepatitis B virus (HBV) infections are at risk for potential flares of hepatitis that can occur with abrupt discontinuation of Lamividine/zidovudine because Lamivudine is also used in low doses for treatment against active HBV.
25 June – A study indicates that the Arctic is warming four times faster than global warming now, substantially faster than current CMIP6 models could project. 27 June With a small catalog of unknown bacteria, researchers suggest work on microbes soon to be released from melting glaciers across the world to identify and understand potential threats in advance and understand extremophiles. Progress in climate change mitigation (CCM) living review-like works:The living document-like aggregation, assessment, integration and review website Project Drawdown adds 11 new CCM solutions to its organized set of mitigation techniques. The website's modeling framework is used in a study document to show that metal recycling has significant potential for CCM (2 June). A revised or updated version of a major worldwide 100% renewable energy proposed plan and model is published (28 June). 28 June Physicists report that interstellar quantum communication by other civilizations could be possible and may be advantageous, identifying some potential challenges and factors for detecting such. They may use, for example, X-ray photons for remotely established channels and quantum teleportation as the communication mode. A review elucidates the current state of climate change extreme event attribution science, concluding probabilities and costs-severities of links as well as identifying potential ways for its improvement. 30 June Samsung announces the first mass production of computer chips using a 3 nm process.
Sources: en.wikipedia.org
Despite challenges faced by the Pakistani film industry, Urdu televised dramas and theatrical performances remain popular, frequently broadcast by many entertainment media outlets. Urdu dramas dominate the television entertainment industry, renowned for their quality since the 1990s. Pakistani music encompasses diverse forms, from provincial folk music and traditional styles like Qawwali and Ghazal Gayaki to modern fusions of traditional and western music. Pakistan boasts numerous renowned folk singers, and the arrival of Afghan refugees in western provinces has sparked interest in Pashto music, despite occasional intolerance.
The word pharmacology is derived from Greek word φάρμακον, pharmakon, meaning "drug" or "poison", together with another Greek word -λογία, logia with the meaning of "study of" or "knowledge of" (cf. the etymology of pharmacy). Pharmakon is related to pharmakos, the ritualistic sacrifice or exile of a human scapegoat or victim in Ancient Greek religion. The modern term pharmacon is used more broadly than the term drug because it includes endogenous substances, and biologically active substances which are not used as drugs. Typically it includes pharmacological agonists and antagonists, but also enzyme inhibitors (such as monoamine oxidase inhibitors).
In signal processing, apodization (from Greek "removing the foot") is the modification of the shape of a mathematical function. The function may represent an electrical signal, an optical transmission, or a mechanical structure. In optics, it is primarily used to remove Airy disks caused by diffraction around an intensity peak, improving the focus.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
=== Food additive === Silica gel, also referred to as silicon dioxide or synthetic amorphous silica (SAS), is listed by the FDA in the United States as generally recognized as safe (GRAS), meaning it can be added to food products without needing approval. Silica is allowed to be added to food in the US at up to 2% as permitted under 21 CFR 172.480. In the EU, it can be in up to 5% concentrations. In 2018, a re-evaluation by the EFSA Panel on Food Additives and Nutrient Sources added to Food found no indications of toxicity even at the highest estimates of exposure level. Listed uses include: anticaking agent, defoaming agent, stabilizer, adsorbent, carrier, conditioning agent, chill proofing agent, filter aid, emulsifying agent, viscosity control agent, and anti-settling agent. Silica can be found commonly in foods including baked goods, spices and herbs, dairy products, cocoa products, and more.
In all, about 100,000 political prisoners and more than 250,000 forced laborers passed through the camps. About half of them probably did not survive the mining work. Uranium mining ceased in 1964. We can only speculate about other victims who died as a result of radiation. Radon-bearing springs discovered during the mining in the early 20th century established a spa industry that is still important today, as well as the town's status as the oldest radium brine spa in the world.
Recently, a new technique called NeuCode SILAC, has augmented the level of multiplexing achievable with metabolic labeling (up to 4). The NeuCode amino acid method is similar to SILAC but differs in that the labeling only utilizes heavy amino acids. The use of only heavy amino acids eliminates the need for 100% incorporation of amino acids needed for SILAC. The increased multiplexing capability of NeuCode amino acids is from the use of mass defects from extra neutrons in the stable isotopes. These small mass differences however need to be resolved on high resolution mass spectrometers. One of the main benefits of SILAC is the level of quantitation bias from processing errors is low because heavy and light samples are combined before sample preparation for MS analysis. SILAC and NeuCode SILAC are excellent techniques for detecting small changes in protein levels or post-translational modifications between experimental groups.
Sources: en.wikipedia.org
Purity is normally expressed as a percentage of total peak area from a chromatographic run. The value depends on the column, gradient and detection wavelength chosen. Results generated under different conditions are therefore not always interchangeable.
Cycling between frozen and thawed states promotes aggregation and can reduce the amount of soluble peptide. Adsorption to container walls also removes material from solution over time. Suppliers generally recommend aliquoting before freezing to limit the number of cycles.
A typical certificate lists lot number, appearance, purity by chromatographic area, identity confirmation and the analytical methods used. Some suppliers add endotoxin or residual solvent results. The document describes the tested lot only and does not extend to other batches.
PT-141 was the development code used for bremelanotide during its preclinical and early clinical programme. The peptide is now generally referred to by its international nonproprietary name.